atp2b1b

Ensembl ID:
ENSDARG00000007788
ZFIN IDs:
ZDB-GENE-080409-1, ZDB-GENE-080409-1
Description:
ATPase, Ca++ transporting, plasma membrane 1b [Source:RefSeq peptide;Acc:NP_001129103]
Human Orthologue:
ATP2B1
Human Description:
ATPase, Ca++ transporting, plasma membrane 1 [Source:HGNC Symbol;Acc:814]
Mouse Orthologue:
Atp2b1
Mouse Description:
ATPase, Ca++ transporting, plasma membrane 1 Gene [Source:MGI Symbol;Acc:MGI:104653]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24661 Nonsense Available for shipment Available now
sa10317 Nonsense Available for shipment Available now
sa12324 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 472 1240 9 20
ENSDART00000121977 Nonsense 459 1227 10 21
Genomic Location:
Chromosome 25 (position 20114526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAGAAAATGATGAAGGACAATAACCTGGTGAGACATCTGGACGCTTG[T/A]GAGACGATGGGCAATGCTACCGCCATTTGCTCGGATAAAACGGGCACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 634 1240 11 20
ENSDART00000121977 Nonsense 621 1227 12 21
Genomic Location:
Chromosome 25 (position 20109715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCAGATGCTGCAAAATCCTGACAAGCAATGGTGATGCCAAACATTTC[A/T]GACCCACTGATCGAGATGACATGGTGACACAGGTGATAGAGCCTATGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 797 1240 14 20
ENSDART00000121977 Nonsense 784 1227 15 21
Genomic Location:
Chromosome 25 (position 20107499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGTTTTTCTTATCTCTTTAAGGTATAATCGATAGCACCGTCTTAGAA[C/T]AGAGACAAGTAGTAGCTGTCACTGGAGATGGAACCAATGATGGTCCTGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
  • Blood pressure: Meta-analysis of genome-wide association studies identifies common variants associated with blood pressure variation in east Asians. (View Study)
  • Coronary heart disease: Genome-wide association study in Han Chinese identifies four new susceptibility loci for coronary artery disease. (View Study)
  • Height: A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. (View Study)
  • Magnesium levels: Genome-wide association studies of serum magnesium, potassium, and sodium concentrations identify six Loci influencing serum magnesium levels. (View Study)
  • Systolic blood pressure: Genome-wide association study of blood pressure and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eoirs2w0