bltk

Ensembl ID:
ENSDARG00000007783
ZFIN ID:
ZDB-GENE-040724-106
Description:
tyrosine-protein kinase Blk [Source:RefSeq peptide;Acc:NP_001025391]
Human Orthologue:
BLK
Human Description:
B lymphoid tyrosine kinase [Source:HGNC Symbol;Acc:1057]
Mouse Orthologue:
Blk
Mouse Description:
B lymphoid kinase Gene [Source:MGI Symbol;Acc:MGI:88169]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29333 Nonsense Mutation detected in F1 DNA During 2017
sa23669 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020099 Nonsense 381 485 11 12
ENSDART00000138028 Nonsense 381 485 14 15
Genomic Location (Zv9):
Chromosome 20 (position 19267632)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19295889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCTATCATTGCATCTTGTTTTATTGATCAGGTGCAAAGTTCCCTATT[A/T]AGTGGACGGCTCCTGAAGCCATCAACTACGGTACTTTCACCATCAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020099 Nonsense 441 485 12 12
ENSDART00000138028 Nonsense 441 485 15 15
Genomic Location (Zv9):
Chromosome 20 (position 19267923)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19296180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATCCGTAACCTTGACAGGAACTATAGGATGCCGTGTCCAGACGCATG[T/A]CCAGGAGAGCTCTATGACATCATGACAAAGTGTTGGATGGAAAAGCCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link