klhdc10

Ensembl ID:
ENSDARG00000007764
ZFIN ID:
ZDB-GENE-040426-776
Description:
kelch domain-containing protein 10 [Source:RefSeq peptide;Acc:NP_956555]
Human Orthologue:
KLHDC10
Human Description:
kelch domain containing 10 [Source:HGNC Symbol;Acc:22194]
Mouse Orthologue:
Klhdc10
Mouse Description:
kelch domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:1924038]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20241 Nonsense Available for shipment Available now
sa31390 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002401 Nonsense 6 393 1 9
ENSDART00000067048 Nonsense 6 424 1 10
ENSDART00000134701 Nonsense 6 173 1 4
Genomic Location (Zv9):
Chromosome 4 (position 14069081)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15004934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGTGGAGGATTTCAGCGTGATTTCTGGAGCGATGTCCAATATTATCTA[T/A]AGGATGTTTGGCGCAGAAGGAGCCCACAGCCCGGACAGACTCAATCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002401 Nonsense 392 393 9 9
ENSDART00000067048 Nonsense 423 424 10 10
ENSDART00000134701   None 173 None 4
Genomic Location (Zv9):
Chromosome 4 (position 14058744)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14994597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCATACAGCTGCTAAACTTGGGCCTCACCCAGGAACTCATTGAACGCT[T/A]AAAATAAACAGGCGGCAGCTGCAAGTGCAAGAGAGACCGATTGTGTACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link