cpne2

Ensembl ID:
ENSDARG00000007753
ZFIN ID:
ZDB-GENE-030131-7896
Description:
copine-2 [Source:RefSeq peptide;Acc:NP_001038540]
Human Orthologue:
CPNE2
Human Description:
copine II [Source:HGNC Symbol;Acc:2315]
Mouse Orthologue:
Cpne2
Mouse Description:
copine II Gene [Source:MGI Symbol;Acc:MGI:2387578]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25060 Nonsense Mutation detected in F1 DNA During 2014
sa1882 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021213 Nonsense 79 563 3 16
ENSDART00000143475 Nonsense 61 131 3 4
Genomic Location:
Chromosome 18 (position 17330991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAATTAAACAAAAAACATATTCTATTTTTTATGTCTTTTCAGCTGGCT[C/T]GAACAGAGACGGCTATTAATAACCTGAATCCAGTATTTGGGGTAAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021213 Nonsense 200 563 6 16
ENSDART00000143475 None None 131 None 4
Genomic Location:
Chromosome 18 (position 17332037)
KASP Assay ID:
554-1872.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCAGGACTTTTTTGGTAAATCAGACCCTTATTTAGAGTTCCACAAA[C/T]AAGGGGATGATGGGAAATGGATGATGGTTCACAGAACAGAGGTAAGGTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/90tafpkd