lmnl3

Ensembl ID:
ENSDARG00000007751
ZFIN ID:
ZDB-GENE-020424-4
Description:
lamin L3 [Source:RefSeq peptide;Acc:NP_694505]
Human Orthologue:
LMNA
Human Description:
lamin A/C [Source:HGNC Symbol;Acc:6636]
Mouse Orthologue:
Lmna
Mouse Description:
lamin A Gene [Source:MGI Symbol;Acc:MGI:96794]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8565 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023944 Essential Splice Site 321 584 5 11
Genomic Location:
Chromosome 23 (position 46175169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCGACTGGAGTCTCAGACGCAGCAGATCAACAACCTGCAGAAACAGG[T/A]GACGCTTCCACCACACAGCTCTGGAGTTCTTCAGARAGGCTTTCAGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rmnho1pc