lmnl3

Ensembl ID:
ENSDARG00000007751
ZFIN ID:
ZDB-GENE-020424-4
Description:
lamin L3 [Source:RefSeq peptide;Acc:NP_694505]
Human Orthologue:
LMNA
Human Description:
lamin A/C [Source:HGNC Symbol;Acc:6636]
Mouse Orthologue:
Lmna
Mouse Description:
lamin A Gene [Source:MGI Symbol;Acc:MGI:96794]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44066 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8565 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023944 Essential Splice Site 279 584 4 11
Genomic Location (Zv9):
Chromosome 23 (position 46176387)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46005500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCCGCCAGTATAAAGACGAGCTGGAGAAAACCTTCAACGCCAAGG[T/G]CAACAACACCACACACAACTGCAGAACAGATCCTGTTTATATCCGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023944 Essential Splice Site 321 584 5 11
Genomic Location (Zv9):
Chromosome 23 (position 46175169)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46006718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCGACTGGAGTCTCAGACGCAGCAGATCAACAACCTGCAGAAACAGG[T/A]GACGCTTCCACCACACAGCTCTGGAGTTCTTCAGARAGGCTTTCAGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link