tsr1

Ensembl ID:
ENSDARG00000007744
ZFIN ID:
ZDB-GENE-030131-3762
Description:
pre-rRNA-processing protein TSR1 homolog [Source:RefSeq peptide;Acc:NP_001032447]
Human Orthologue:
TSR1
Human Description:
TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25542]
Mouse Orthologue:
Tsr1
Mouse Description:
TSR1, 20S rRNA accumulation, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2144566]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39049 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7406 Missense Mutation detected in F1 DNA During 2016
sa42557 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052645 Essential Splice Site 41 836 None 15
ENSDART00000135409 Essential Splice Site 41 476 None 10

The following transcripts of ENSDARG00000007744 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 24970282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCATGGAAAACATCGAACTAAAGGCGAGATCGGCCGGGAGAACAAGGG[T/C]ATGTTTAATGGGATTATTCATAAGTAATGTTACACGCGCTCGCACCGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052645 Missense 244 836 5 15
ENSDART00000135409 Missense 244 476 5 10

The following transcripts of ENSDARG00000007744 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 24975724)
KASP Assay ID:
554-4127.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGCACGTCTCTTCCCTGTGGAYKGTGATCAGGATGCYGTTTTGCTTC[T/A]ACGGCACTTGTCAGCGCAAAAACAGAGGCGTCTGGGGTTCCGCTCTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052645 Nonsense 367 836 6 15
ENSDART00000135409 Nonsense 367 476 6 10

The following transcripts of ENSDARG00000007744 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 24978098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATGTTCGGGTGTTGATGAAAGCAGACCCTGCTCAGAGAGAGAGCCTA[C/T]AGGCAGAGGCAGAAGTCGACCCCATGGAGGGAGAGCAGACGTGGCCCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link