tsr1

Ensembl ID:
ENSDARG00000007744
ZFIN ID:
ZDB-GENE-030131-3762
Description:
pre-rRNA-processing protein TSR1 homolog [Source:RefSeq peptide;Acc:NP_001032447]
Human Orthologue:
TSR1
Human Description:
TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25542]
Mouse Orthologue:
Tsr1
Mouse Description:
TSR1, 20S rRNA accumulation, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2144566]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7406 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052645 Missense 244 836 5 15
ENSDART00000135409 Missense 244 476 5 10

The following transcripts of ENSDARG00000007744 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 24975724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGCACGTCTCTTCCCTGTGGAYKGTGATCAGGATGCYGTTTTGCTTC[T/A]ACGGCACTTGTCAGCGCAAAAACAGAGGCGTCTGGGGTTCCGCTCTCGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4og6vw04