atp1a1a.2

Ensembl ID:
ENSDARG00000007739
ZFIN ID:
ZDB-GENE-001212-2
Description:
ATPase, Na+/K+ transporting, alpha 1a.2 polypeptide [Source:RefSeq peptide;Acc:NP_571762]
Human Orthologue:
ATP1A1
Human Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide [Source:HGNC Symbol;Acc:799]
Mouse Orthologue:
Atp1a1
Mouse Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88105]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31186 Nonsense Mutation detected in F1 DNA During 2016
sa38237 Nonsense Mutation detected in F1 DNA During 2016
sa31187 Nonsense Mutation detected in F1 DNA During 2016
sa19399 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006449 Nonsense 88 1023 4 22

The following transcripts of ENSDARG00000007739 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1547584)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGGACCGCGATGGGCCGAATGCATTGACCCCACCTCCTACAACTCCA[C/T]AATGGGTGAAGTTCTGCAAACAGCTCTTCGGTGGTTTCCAAACTCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006449 Nonsense 437 1023 9 22

The following transcripts of ENSDARG00000007739 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1550401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCGCTCGTGTTGCTGGCCTCTGCAATCGCGCCGTCTTCCGTGCTGAA[C/T]AAAGCCATCTCCCAGTCCTTAATGTGAGCTTGTCTCCAGATTTCCTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006449 Nonsense 625 1023 13 22

The following transcripts of ENSDARG00000007739 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1551400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTCAATACAGGTCATCATGGTTACTGGTGACCATCCAATTACAGCT[A/T]AAGCTATTGCAAAAGGTGTTGGCATCATCTCAGAAGGCAATGAGACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006449 Splice Site, Nonsense 658 1023 13 22

The following transcripts of ENSDARG00000007739 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1551499)
KASP Assay ID:
2259-0051.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAGACATTGCCGCTCGCATGAACATCCCTGTTGGAGAGGTTAATCCG[A/T]GGTAAACCCAACCACCTAAAACACAGCAACAATTTAAATAAATATATTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link