si:ch211-11m18.3

Ensembl ID:
ENSDARG00000007737
ZFIN ID:
ZDB-GENE-041014-17
Description:
Protein zyg-11 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5TYQ1]
Human Orthologues:
ZYG11A, ZYG11B
Human Descriptions:
zyg-11 homolog A (C. elegans) [Source:HGNC Symbol;Acc:32058]
zyg-11 homolog B (C. elegans) [Source:HGNC Symbol;Acc:25820]
Mouse Orthologues:
Zyg11a, Zyg11b
Mouse Descriptions:
zyg-11 homolog A (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2446208]
zyg-ll homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2685277]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31042 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43405 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104112 Essential Splice Site 445 746 None 16
ENSDART00000129633   446 445 7 7
Genomic Location (Zv9):
Chromosome 20 (position 16227463)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 16287416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCTCTCTGTGCAGTGATCGTATCTTGCAGGAGGTTCCCTTTAACAGG[T/C]GACACATTGCACATGATCTATAATTCATTGCACACACATAAACATGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104112 Essential Splice Site 549 746 10 16
ENSDART00000129633   None 445 None 7
Genomic Location (Zv9):
Chromosome 20 (position 16234377)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 16294330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTTCATCGAGAACCAGGGGCTGGAGCTCTTCATCAAAGTGCTGGAGG[T/C]GAACATTGATTAAATGTGATTGTAATCTGATAAAGCTGTCCTGAACGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link