rgl2

Ensembl ID:
ENSDARG00000007727
ZFIN ID:
ZDB-GENE-010131-1
Description:
ral guanine nucleotide dissociation stimulator-like 2 [Source:RefSeq peptide;Acc:NP_001108565]
Human Orthologue:
RGL2
Human Description:
ral guanine nucleotide dissociation stimulator-like 2 [Source:HGNC Symbol;Acc:9769]
Mouse Orthologue:
Rgl2
Mouse Description:
ral guanine nucleotide dissociation stimulator-like 2 Gene [Source:MGI Symbol;Acc:MGI:107483]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7429 Missense Mutation detected in F1 DNA During 2017
sa36250 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004052 Missense 525 722 16 19
ENSDART00000130425 Missense 547 744 16 19
Genomic Location (Zv9):
Chromosome 16 (position 48434494)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45403701
KASP Assay ID:
554-4079.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNAGATTRTGTATTGTCCTGTTTTCAGCRCTCTCTCAGCTGTTGCCAATA[C/T]GACAATGGATGCTGAYGGCATATTTGACTTTCCATCTCCTGTCAATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004052 Nonsense 572 722 17 19
ENSDART00000130425 Nonsense 594 744 17 19
Genomic Location (Zv9):
Chromosome 16 (position 48432267)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45401474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTGTCTGGACGTTGATTCGTCACCGCCATCCAATGATTCCACGCCCT[C/A]AATCCTGACCACACCCACTACAGCTGTCAAATCACATCGCCGCTCTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link