lgsn

Ensembl ID:
ENSDARG00000007715
ZFIN ID:
ZDB-GENE-060312-26
Description:
lengsin [Source:RefSeq peptide;Acc:NP_001026844]
Human Orthologue:
LGSN
Human Description:
lengsin, lens protein with glutamine synthetase domain [Source:HGNC Symbol;Acc:21016]
Mouse Orthologue:
Lgsn
Mouse Description:
lengsin, lens protein with glutamine synthetase domain Gene [Source:MGI Symbol;Acc:MGI:2672844]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21859 Nonsense Mutation detected in F1 DNA During 2014
sa3788 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020256 Nonsense 477 668 4 4
Genomic Location:
Chromosome 11 (position 11385541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTACATTGCCACCTTTTTCACCTACGAGAACATCCAGAATTCAGGTT[T/A]ACTCTCCCATAGCCTCTGGGATGCAAGTGGCAGAAGAAGCCTTTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020256 Nonsense 594 668 4 4
Genomic Location:
Chromosome 11 (position 11385191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTTAYATTGTGTTGGCAGCCACTATAGCAGCAGGACTGGACGGARTC[A/T]AGCGTAATCTCAATGCAGAACAGGTACTAAGCAGAGCTCCAAATCAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kz4xpikb