lgsn

Ensembl ID:
ENSDARG00000007715
ZFIN ID:
ZDB-GENE-060312-26
Description:
lengsin [Source:RefSeq peptide;Acc:NP_001026844]
Human Orthologue:
LGSN
Human Description:
lengsin, lens protein with glutamine synthetase domain [Source:HGNC Symbol;Acc:21016]
Mouse Orthologue:
Lgsn
Mouse Description:
lengsin, lens protein with glutamine synthetase domain Gene [Source:MGI Symbol;Acc:MGI:2672844]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27737 Nonsense Mutation detected in F1 DNA During 2015
sa21859 Nonsense Mutation detected in F1 DNA During 2015
sa3788 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa27737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020256 Nonsense 127 668 2 4
Genomic Location:
Chromosome 11 (position 11387550)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGAGGGTGGCGTTCCCAAACAAACCATGGATGAACTGAAAAGTGTGT[T/A]GCGTGAGAGTTCCCTACTGAGTGCAAAAGGACAAGATGAAGGACGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020256 Nonsense 477 668 4 4
Genomic Location:
Chromosome 11 (position 11385541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTACATTGCCACCTTTTTCACCTACGAGAACATCCAGAATTCAGGTT[T/A]ACTCTCCCATAGCCTCTGGGATGCAAGTGGCAGAAGAAGCCTTTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020256 Nonsense 594 668 4 4
Genomic Location:
Chromosome 11 (position 11385191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTTAYATTGTGTTGGCAGCCACTATAGCAGCAGGACTGGACGGARTC[A/T]AGCGTAATCTCAATGCAGAACAGGTACTAAGCAGAGCTCCAAATCAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kz4xpikb