ube2q1

Ensembl ID:
ENSDARG00000007714
ZFIN IDs:
ZDB-GENE-050522-329, ZDB-GENE-050522-329
Description:
ubiquitin-conjugating enzyme E2 Q2 [Source:RefSeq peptide;Acc:NP_001018415]
Human Orthologues:
AC011295.5, UBE2Q2, UBE2Q2P2
Human Descriptions:
ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 2 [Source:HGNC Symbol;Acc:37440]
ubiquitin-conjugating enzyme E2Q family member 2 [Source:HGNC Symbol;Acc:19248]
Mouse Orthologues:
E330021D16Rik, Ube2q2
Mouse Descriptions:
RIKEN cDNA E330021D16 gene Gene [Source:MGI Symbol;Acc:MGI:2141773]
ubiquitin-conjugating enzyme E2Q (putative) 2 Gene [Source:MGI Symbol;Acc:MGI:2388672]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23391 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017798 Nonsense 243 244 8 14
ENSDART00000097333 None 238 372 7 13
Genomic Location:
Chromosome 18 (position 49539782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATCTACTCAGTGGAGCTGCTCAATGACAGTTTGTACGATTGGCACAT[C/A]AAGCTGAGAACGTAAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tsla4gey