LOC100331248

Ensembl ID:
ENSDARG00000007711
Human Orthologue:
RAB3IL1
Human Description:
RAB3A interacting protein (rabin3)-like 1 [Source:HGNC Symbol;Acc:9780]
Mouse Orthologue:
Rab3il1
Mouse Description:
RAB3A interacting protein (rabin3)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922010]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10784 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022506 Essential Splice Site 250 332 6 9
Genomic Location:
Chromosome 25 (position 3077714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACATCCTCCCTGCCCACCGACAAAAACATCCATCAAGGAGGAACAAA[G/A]TAAGTMACAGATGRACGAATCTTHACGAATGAACTTTACAAATGACTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)
  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dxsjot08