adamts8a

Ensembl ID:
ENSDARG00000007709
ZFIN ID:
ZDB-GENE-060526-202
Description:
Novel protein similar to vertebrate ADAM metallopeptidase with thrombospondin type 1 motif, 8 (ADAMT
Human Orthologue:
ADAMTS8
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 8 [Source:HGNC Symbol;Acc:224]
Mouse Orthologue:
Adamts8
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 Gene [

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14348 Nonsense Available for shipment Available now
sa40460 Nonsense Mutation detected in F1 DNA During 2016
sa13542 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098300 Nonsense 193 884 1 9
Genomic Location (Zv9):
Chromosome 5 (position 31815411)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29576241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAGCGTCTTTGGTCTTTGATCAAATGAAAGTTGACAGTCTTGTGAAA[G/T]AGAGCAAACTGAACTCCAGTGAAGATGAAGACRGCAACATGAGACGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098300 Nonsense 588 884 7 9
Genomic Location (Zv9):
Chromosome 5 (position 31798761)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29559591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTGTCCTTTTTTTAATCCACAGGAAAAAGCTTCAGAGAGGAGCAGTG[T/A]GAGAAGTATAACAGTGACCGTTACATGGACATTAAAGGGAACATAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098300 Essential Splice Site 696 884 8 9
Genomic Location (Zv9):
Chromosome 5 (position 31797946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29558776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGATGGTACAACCTGCAGGAAAATAAGTGGTTCGCTAAACAAAGCTAC[G/T]TAAGTGAAAATCATATTTTTAAGCAATTCATTTAAAAAAAAWNKAAATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link