adamts8a

Ensembl ID:
ENSDARG00000007709
ZFIN ID:
ZDB-GENE-060526-202
Description:
Novel protein similar to vertebrate ADAM metallopeptidase with thrombospondin type 1 motif, 8 (ADAMT
Human Orthologue:
ADAMTS8
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 8 [Source:HGNC Symbol;Acc:224]
Mouse Orthologue:
Adamts8
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 Gene [

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14348 Nonsense Available for shipment Available now
sa13542 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098300 Nonsense 193 884 1 9
Genomic Location:
Chromosome 5 (position 31815411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAGCGTCTTTGGTCTTTGATCAAATGAAAGTTGACAGTCTTGTGAAA[G/T]AGAGCAAACTGAACTCCAGTGAAGATGAAGACRGCAACATGAGACGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098300 Essential Splice Site 696 884 8 9
Genomic Location:
Chromosome 5 (position 31797946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGATGGTACAACCTGCAGGAAAATAAGTGGTTCGCTAAACAAAGCTAC[G/T]TAAGTGAAAATCATATTTTTAAGCAATTCATTTAAAAAAAAWNKAAATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jrvmfaai