nsa2

Ensembl ID:
ENSDARG00000007708
ZFIN ID:
ZDB-GENE-030131-488
Description:
ribosome biogenesis protein NSA2 homolog [Source:RefSeq peptide;Acc:NP_955862]
Human Orthologue:
NSA2
Human Description:
NSA2 ribosome biogenesis homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:30728]
Mouse Orthologue:
Nsa2
Mouse Description:
NSA2 ribosome biogenesis homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913883]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10204 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021976 Essential Splice Site 1 260 1 6
Genomic Location (Zv9):
Chromosome 21 (position 4047608)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3644864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACCTGGTAGCTCCATAAACACTTTAACAACACAGACTTCATCATGG[T/C]AAGTAGAAAATGACCGTCAATGTCGTGTAAAAACCTTTGTTTAGAGCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link