nfkbiab

Ensembl ID:
ENSDARG00000007693
ZFIN ID:
ZDB-GENE-030131-1819
Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha b [Source:RefSe
Human Orthologue:
NFKBIA
Human Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha [Source:HGNC Sym
Mouse Orthologue:
Nfkbia
Mouse Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18322 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016597 Nonsense 127 312 3 6

The following transcripts of ENSDARG00000007693 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 12807263)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12789785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGCACTGCATTTGGCCATCATCACAGATCARCCTCTCATAGTGGAG[C/T]AGTTACTAAAAGCCGGCTGCGATGCATCTTTGGTGGATGACCATGGTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: A genome-wide association study identifies new psoriasis susceptibility loci and an interaction between HLA-C and ERAP1. (View Study)
  • Psoriasis: Genome-wide association analysis identifies three psoriasis susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link