cul1b

Ensembl ID:
ENSDARG00000007691
ZFIN ID:
ZDB-GENE-040426-2887
Description:
cullin 1-like [Source:RefSeq peptide;Acc:NP_998660]
Human Orthologue:
CUL1
Human Description:
cullin 1 [Source:HGNC Symbol;Acc:2551]
Mouse Orthologue:
Cul1
Mouse Description:
cullin 1 Gene [Source:MGI Symbol;Acc:MGI:1349658]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1559 Essential Splice Site Available for shipment Available now
sa24472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024691 Essential Splice Site None 774 1 22
ENSDART00000122757 Essential Splice Site None 320 1 10
ENSDART00000134947 Essential Splice Site None 775 1 22

The following transcripts of ENSDARG00000007691 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 17949169)
KASP Assay ID:
554-1502.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGCAGGGCCTCGACCTCACACTGCTCGACGTTACAAACACACACAGG[T/A]AAGACTAAAAATCTTTAAACACGTGTCAGGCGTCCCGGTTTGACATAAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024691 Nonsense 411 774 11 22
ENSDART00000122757 None None 320 None 10
ENSDART00000134947 Nonsense 412 775 11 22

The following transcripts of ENSDARG00000007691 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 17920972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGCCTGTGGAAGATTCATTAATAATAATGCAGTAACAAGAATGGCA[C/T]AGTCCTCCAGCAAATCCCCTGAGCTTCTGGCCAGATACTGTGACTCCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g25dsogf