ppdpfa

Ensembl ID:
ENSDARG00000007682
ZFIN ID:
ZDB-GENE-030219-204
Description:
Pancreatic progenitor cell differentiation and proliferation factor A [Source:UniProtKB/Swiss-Prot;A
Human Orthologue:
PPDPF
Human Description:
pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish) [Source:HGNC
Mouse Orthologue:
Ppdpf
Mouse Description:
pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)RIKEN cDNA 27

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21282 Essential Splice Site Available for shipment Available now
sa6098 Missense, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032996 Essential Splice Site 45 117 None 5
ENSDART00000137536 Essential Splice Site 45 90 None 5

The following transcripts of ENSDARG00000007682 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24068249)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23194067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTAGCAGTTCGGAGTACACTGGGGAGGTCATTCCACACCCACCAGG[T/C]ACAAACAAAGCATCACATCAGTACCACAATGACTGCATTACAAATACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032996 Missense 47 117 4 5
ENSDART00000137536 Nonsense 54 90 4 5

The following transcripts of ENSDARG00000007682 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24068358)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23194176
KASP Assay ID:
554-3886.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCTCTCACTGTGCCAAAAGCTCAAGGTGTTCTTGCACGGCAGGTCTG[G/A]CACGTCWGGACTCTGGCCACTGGTGGTCCAGTTTCTTCTTTGGGAAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link