crybb1l3

Ensembl ID:
ENSDARG00000007655
ZFIN ID:
ZDB-GENE-070820-11
Description:
crystallin, beta B1, like 3 [Source:RefSeq peptide;Acc:NP_001095860]
Human Orthologue:
CRYBB1
Human Description:
crystallin, beta B1 [Source:HGNC Symbol;Acc:2397]
Mouse Orthologue:
Crybb1
Mouse Description:
crystallin, beta B1 Gene [Source:MGI Symbol;Acc:MGI:104992]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42562 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39052 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100293 Essential Splice Site 22 208 2 6
ENSDART00000140092 Essential Splice Site 22 203 2 6
Genomic Location (Zv9):
Chromosome 15 (position 27446761)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28165001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGGAAGTATGGGAAGTCGCTTTGCCACAGGAAAGAGCTCCCACAGAG[T/A]ATGTCAAACTTATCATGCCCTTAGATTCTCGCCTTCCTGTTACATGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100293 Nonsense 137 208 5 6
ENSDART00000140092 Nonsense 132 203 5 6
Genomic Location (Zv9):
Chromosome 15 (position 27449793)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28168033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACGGTCGTAAGATGGAAGTTTCTGATGAGGACATCCCAAGTTTGTG[G/A]TGCCATGGCTTCCAGGACAGAGTTGGCAGCATTCAAGTAAATGGTGGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link