nsfa

Ensembl ID:
ENSDARG00000007654
ZFIN ID:
ZDB-GENE-030616-37
Description:
vesicle-fusing ATPase [Source:RefSeq peptide;Acc:NP_001037793]
Human Orthologue:
NSF
Human Description:
N-ethylmaleimide-sensitive factor [Source:HGNC Symbol;Acc:8016]
Mouse Orthologue:
Nsf
Mouse Description:
N-ethylmaleimide sensitive fusion protein Gene [Source:MGI Symbol;Acc:MGI:104560]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33227 Nonsense Mutation detected in F1 DNA During 2017
sa33226 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103043 Nonsense 76 744 4 21
Genomic Location (Zv9):
Chromosome 3 (position 34869514)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34654710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTCTTAACCCTTCTTAAAGAGGAAATGGGCAGGCCTGTCCATTGGG[C/T]AAGAAATAGAAGGTGTGTATATTATTCCTGGAGAACATTTAGAACACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103043 Essential Splice Site 587 744 15 21
Genomic Location (Zv9):
Chromosome 3 (position 34862182)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34647378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGATGATCGGCCACTCAGAGATCTCCAAATGCCAGGCAATCAAGAAG[G/T]TTAGTGGTTAACATACAGTATAGTATCTCACAAATACATTGAAGAATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link