nsfa

Ensembl ID:
ENSDARG00000007654
ZFIN ID:
ZDB-GENE-030616-37
Description:
vesicle-fusing ATPase [Source:RefSeq peptide;Acc:NP_001037793]
Human Orthologue:
NSF
Human Description:
N-ethylmaleimide-sensitive factor [Source:HGNC Symbol;Acc:8016]
Mouse Orthologue:
Nsf
Mouse Description:
N-ethylmaleimide sensitive fusion protein Gene [Source:MGI Symbol;Acc:MGI:104560]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33227 Nonsense Mutation detected in F1 DNA During 2017
sa44566 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33226 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103043 Nonsense 76 744 4 21
Genomic Location (Zv9):
Chromosome 3 (position 34869514)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34654710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTCTTAACCCTTCTTAAAGAGGAAATGGGCAGGCCTGTCCATTGGG[C/T]AAGAAATAGAAGGTGTGTATATTATTCCTGGAGAACATTTAGAACACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103043 Essential Splice Site 248 744 8 21
Genomic Location (Zv9):
Chromosome 3 (position 34866616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGCCTTTGCCTCTCGAGTCTTTCCTCCAGACATTGTGGAGCAGATGG[G/A]TATGTGCTGTTTGTTCCTTTCATAATAAAAGTCATCCATGTTCCAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103043 Essential Splice Site 587 744 15 21
Genomic Location (Zv9):
Chromosome 3 (position 34862182)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34647378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGATGATCGGCCACTCAGAGATCTCCAAATGCCAGGCAATCAAGAAG[G/T]TTAGTGGTTAACATACAGTATAGTATCTCACAAATACATTGAAGAATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link