mkrn2

Ensembl ID:
ENSDARG00000007630
ZFIN IDs:
ZDB-GENE-020213-2, ZDB-GENE-020213-2, ZDB-GENE-020213-2
Description:
Probable E3 ubiquitin-protein ligase makorin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q9DFG8]
Human Orthologue:
MKRN2
Human Description:
makorin ring finger protein 2 [Source:HGNC Symbol;Acc:7113]
Mouse Orthologue:
Mkrn2
Mouse Description:
makorin, ring finger protein, 2 Gene [Source:MGI Symbol;Acc:MGI:1914277]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34998 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019997 Essential Splice Site 370 414 7 9
ENSDART00000122555   None 304 None 7
ENSDART00000128544   None 301 None 8
ENSDART00000130504 Essential Splice Site 370 414 7 8
Genomic Location (Zv9):
Chromosome 11 (position 554258)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 540995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAACCTGACAAACCCCGAAAACAGCTCAGCGCTGAGGGAAACGTGCGG[G/A]TAAACACACACACACAAACAAACACCTTACAGACATGCACAAATACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link