ENSDARG00000007582

Ensembl ID:
ENSDARG00000007582
Human Orthologue:
GPRC6A
Human Description:
G protein-coupled receptor, family C, group 6, member A [Source:HGNC Symbol;Acc:18510]
Mouse Orthologue:
Gprc6a
Mouse Description:
G protein-coupled receptor, family C, group 6, member A Gene [Source:MGI Symbol;Acc:MGI:2429498]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1960 Nonsense F2 line generated During 2014
sa15865 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1960
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022725 Nonsense 50 822 1 6
Genomic Location:
Chromosome 20 (position 119240)
KASP Assay ID:
554-1948.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCGCAATCCTGAGCTCAATTCACTCTAAGGTGAGGAACCTTCACCAG[C/T]GAACCAGACCACARCCATTCATCTGCTCTGAGTGAGTATGCACAACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022725 Nonsense 795 822 6 6
Genomic Location:
Chromosome 20 (position 125830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCATCCTGGCCTCCAACTACGGCATCATGTTCTGTCATTTTCTCCCC[A/T]AGTGTTATGTGGTGCWGTGGGAGCTGTCCGAGAACTCTAGRGCGATTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • Prostate cancer: Genome-wide association study identifies five new susceptibility loci for prostate cancer in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kxrevxs5