ENSDARG00000007582

Ensembl ID:
ENSDARG00000007582
Human Orthologue:
GPRC6A
Human Description:
G protein-coupled receptor, family C, group 6, member A [Source:HGNC Symbol;Acc:18510]
Mouse Orthologue:
Gprc6a
Mouse Description:
G protein-coupled receptor, family C, group 6, member A Gene [Source:MGI Symbol;Acc:MGI:2429498]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1960 Nonsense F2 line generated During 2016
sa36925 Nonsense Mutation detected in F1 DNA During 2016
sa15865 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1960
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022725 Nonsense 50 822 1 6
Genomic Location (Zv9):
Chromosome 20 (position 119240)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 109835
KASP Assay ID:
554-1948.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCGCAATCCTGAGCTCAATTCACTCTAAGGTGAGGAACCTTCACCAG[C/T]GAACCAGACCACARCCATTCATCTGCTCTGAGTGAGTATGCACAACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022725 Nonsense 138 822 2 6
Genomic Location (Zv9):
Chromosome 20 (position 121231)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 111826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGGACTATTCAGACTTCTGTCCACCATCCAAAGCAATAATGGGAGAA[A/T]GATACTCTGAGTTATCCATCGCTATCGCCAAGCTCCTCAGCCTCTACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022725 Nonsense 795 822 6 6
Genomic Location (Zv9):
Chromosome 20 (position 125830)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 116425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCATCCTGGCCTCCAACTACGGCATCATGTTCTGTCATTTTCTCCCC[A/T]AGTGTTATGTGGTGCWGTGGGAGCTGTCCGAGAACTCTAGRGCGATTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • Prostate cancer: Genome-wide association study identifies five new susceptibility loci for prostate cancer in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link