crybb1l1

Ensembl ID:
ENSDARG00000007576
ZFIN ID:
ZDB-GENE-100112-3
Description:
LOC553473 protein [Source:UniProtKB/TrEMBL;Acc:Q502C7]
Human Orthologue:
CRYBB1
Human Description:
crystallin, beta B1 [Source:HGNC Symbol;Acc:2397]
Mouse Orthologue:
Crybb1
Mouse Description:
crystallin, beta B1 Gene [Source:MGI Symbol;Acc:MGI:104992]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16591 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074097 Nonsense 26 237 3 7
ENSDART00000123832 Nonsense 8 220 2 6
Genomic Location:
Chromosome 14 (position 49245232)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCTCTATTCTGATTGGCCCCMMAGGCATCATGTCTTCCAGTGGAGAAAAA[A/T]AGACCGCCTCCCAGACCGACGGCAAGGGAGCCCCCAGCAAGAAGTCCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/554jfm86