appbp2

Ensembl ID:
ENSDARG00000007566
ZFIN ID:
ZDB-GENE-030131-1715
Description:
amyloid protein-binding protein 2 [Source:RefSeq peptide;Acc:NP_997798]
Human Orthologue:
APPBP2
Human Description:
amyloid beta precursor protein (cytoplasmic tail) binding protein 2 [Source:HGNC Symbol;Acc:622]
Mouse Orthologue:
Appbp2
Mouse Description:
amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4606 Nonsense F2 line generated During 2014
sa1303 Essential Splice Site Available for shipment Available now
sa16354 Nonsense Available for shipment Available now
sa15168 Nonsense Available for shipment Available now
sa13157 Essential Splice Site Available for shipment Available now
sa22644 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4606
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002824 Nonsense 45 446 1 11
ENSDART00000110234 Nonsense 45 586 1 14
ENSDART00000137569 None None 246 None 6
Genomic Location:
Chromosome 15 (position 23296064)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACGGGACATCCGATCTCTCCCCGAAAATATACAGTTTGATGTGTACTA[C/A]AAGGTAAGAAGCACGATGATGGAGTTYAGGGCGGAACAGCCGTCAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002824 Essential Splice Site 224 446 5 11
ENSDART00000110234 Essential Splice Site 224 586 5 14
ENSDART00000137569 Essential Splice Site 193 246 4 6
Genomic Location:
Chromosome 15 (position 23285437)
KASP Assay ID:
554-1218.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGGAGAACTGTGTGCCCTGCTTTTTGCCAAAAGCCACTATGATGAGG[T/C]GAGTCCCCTTGCAACTGTCCCAGAAGTCTGTTTGGAGAAGGCCTGTTCTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002824 Nonsense 287 446 8 11
ENSDART00000110234 Nonsense 287 586 8 14
ENSDART00000137569 None None 246 None 6
Genomic Location:
Chromosome 15 (position 23285008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTTCACATTTTTTTCAGGGAACATTTTGGGCAYAAGCATCCAAAATA[T/A]TCAGAYACACTACTAGATTATGGGTTTTATCTCTTAAACGTGGATAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002824 Nonsense 306 446 8 11
ENSDART00000110234 Nonsense 306 586 8 14
ENSDART00000137569 None None 246 None 6
Genomic Location:
Chromosome 15 (position 23284953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYACACTACTAGATTATGGGTTTTATCTCTTAAACGTGGATAATATCTGT[C/T]AATCTGTGACCATTTACCAGGTGAGAAAATAATCGMTTTAWATGTGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002824 Essential Splice Site 313 446 9 11
ENSDART00000110234 Essential Splice Site 313 586 9 14
ENSDART00000137569 None None 246 None 6
Genomic Location:
Chromosome 15 (position 23284843)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAMTTTCTCAWTTGTTTGAAAGACTAAAGGCATTTCATTTGTTATTCA[G/T]ACTGCATTAGATATTCGGCAGTCAGTGTTTGGAGGAAAGAATATTCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002824 None None 446 None 11
ENSDART00000110234 Nonsense 543 586 13 14
ENSDART00000137569 None None 246 None 6
Genomic Location:
Chromosome 15 (position 23276733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGGAAACTATGAGAAGGTATTTGAGTATCACAATATTCTGTCCAACT[G/A]GAACCGTTTAAGGGACAGGCAGTTTGCCGTAGCCGATGCGCTGGAGGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/923kftkx