NP_999974.1

Ensembl ID:
ENSDARG00000007561
Description:
cadherin-23 [Source:RefSeq peptide;Acc:NP_999974]
Mouse Orthologue:
Cdh23
Mouse Description:
cadherin 23 (otocadherin) Gene [Source:MGI Symbol;Acc:MGI:1890219]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6329 Nonsense Mutation detected in F1 DNA During 2017
sa35577 Nonsense Mutation detected in F1 DNA During 2017
sa31961 Nonsense Available for shipment Available now
sa35578 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42289 Nonsense Mutation detected in F1 DNA During 2017
sa28193 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa28194 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016602 Nonsense 328 2678 7 51
Genomic Location (Zv9):
Chromosome 13 (position 43745982)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42961188
KASP Assay ID:
554-4508.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCCAGTGTTTATAACRTGTCTCTGGAGGAGAGCGTACCCCGTGATTA[T/A]CTGGTGRTCAGACTCAACTGCACGGATAATGACGCGGGTCTAAATGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016602 Nonsense 589 2678 13 51
Genomic Location (Zv9):
Chromosome 13 (position 43778961)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42994077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGACGTGAGTACTGGTCTGCTAACCACGGTGGACTATTTGGACTAC[G/T]AGACCAAGACGAGTTATTTAATGAACGTCTCAGCCACAGATCAGTCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016602 Nonsense 848 2678 18 51
Genomic Location (Zv9):
Chromosome 13 (position 43786259)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43001375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTAGATGTGAACGATAACCCTCCCGTACTGCAGAGTCCTCGAGGGTA[C/A]AACGTCAGCGTCAGTGAGGTCAGAACACAGCACCTCAAACCAGAGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016602 Essential Splice Site 931 2678 20 51
Genomic Location (Zv9):
Chromosome 13 (position 43818281)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43033397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATTAAAAGTATTTTTTTAATGTCTTGCTGCTTGTGATCTACTTCCAT[A/G]GACATCCACCACCGTTTGGGTGCGTATAATTGATGAAAACGACAACGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016602 Nonsense 1132 2678 23 51
Genomic Location (Zv9):
Chromosome 13 (position 43825445)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43040561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGAGTGAGGAAAGACATTGAGCTTGACAGAGAAACAATTGCCTATTA[C/A]AACATCACTATTACCGCCAAAGATTTGGGAACGCCTTCGCTCAATGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016602 Splice Site, Nonsense 1668 2678 32 51
Genomic Location (Zv9):
Chromosome 13 (position 43843465)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43058581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTATATTCAGTCTAAATTGTGATCTTCCAAATCTTTACCCGCAGGT[A/T]AAATTGTGGCCAATCGGACGGTGGATTTTGAGCAAGTGCAGTGGTTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016602 Essential Splice Site 2228 2678 42 51
Genomic Location (Zv9):
Chromosome 13 (position 43863686)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43078802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGATCAGTGTATTTGAATTTCATGTCCTGATCATTTGTTTTTTTTTC[A/G]GGTGAGACTGACGGAATCATCTGCACGTTTGACCTCTTTATGGCTTACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link