sema3bl

Ensembl ID:
ENSDARG00000007560
ZFIN ID:
ZDB-GENE-030131-2956
Description:
semaphorin-3G [Source:RefSeq peptide;Acc:NP_001116184]
Human Orthologue:
SEMA3G
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G [Source:HGNC
Mouse Orthologue:
Sema3g
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G Gene [Source:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34420 Nonsense Available for shipment Available now
sa21309 Nonsense Available for shipment Available now
sa15484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010393   None 204 None 7
ENSDART00000046863 Nonsense 72 771 2 15
ENSDART00000140980   None 182 None 5
Genomic Location (Zv9):
Chromosome 8 (position 27392482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26520400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATGAATATCATGACAGGCTTTTCCTGGGAGGGAAGGATGTTCTCTA[C/A]TCACTCAGACTGGATCACACGCATGATGCTAAAGAGGTAACACAGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010393   None 204 None 7
ENSDART00000046863 Nonsense 291 771 8 15
ENSDART00000140980   None 182 None 5
Genomic Location (Zv9):
Chromosome 8 (position 27417428)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26545346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATAAGTGGAGCACATTTATTAAAGCCCGACTGGTGTGTTCAGTTCCT[G/T]GACCTCACGGCATCCAAACACACTTTCATCAGCTAGGTGAGACCAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010393   None 204 None 7
ENSDART00000046863 Essential Splice Site 616 771 14 15
ENSDART00000140980 Essential Splice Site 164 182 4 5
Genomic Location (Zv9):
Chromosome 8 (position 27424243)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26552161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGCCACTGTCACATGGCACATTCAGAGAGATGACTAYTTAGGGGAGG[T/C]GAGAGACTAAAGCAGGTCSCACACCAGAAGCGCCGCNNNNNNNNNGCAGCGCCACGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link