pdxdc1

Ensembl ID:
ENSDARG00000007549
ZFIN ID:
ZDB-GENE-040912-16
Description:
Pyridoxal-dependent decarboxylase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q66HY
Human Orthologue:
PDXDC1
Human Description:
pyridoxal-dependent decarboxylase domain containing 1 [Source:HGNC Symbol;Acc:28995]
Mouse Orthologue:
Pdxdc1
Mouse Description:
pyridoxal-dependent decarboxylase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1920909]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40115 Nonsense Mutation detected in F1 DNA During 2017
sa33245 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027092 Nonsense 515 751 18 23
ENSDART00000144696 Nonsense 530 766 18 23

The following transcripts of ENSDARG00000007549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 36551746)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36497358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAATCAGGTTTGAGCCCAGAACCACAGACCTGGATGAAGACAAAAGA[C/T]AAGACAGGGTGGAGAAGATCAACAGTGACTTGCTGAAGAAACTGATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027092 Essential Splice Site 541 751 18 23
ENSDART00000144696 Essential Splice Site 556 766 18 23

The following transcripts of ENSDARG00000007549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 36551666)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36497438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGAAGAAACTGATGGAGCTGGACACAGATCTCAACTTCTCTGGTGG[T/G]AAATGACTGAATTTTTCTCATGAATCACAGCTGTGGTTTTTAATGCATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Metabolic traits: Human metabolic individuality in biomedical and pharmaceutical research. (View Study)
  • Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)
  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link