mll5

Ensembl ID:
ENSDARG00000007523
ZFIN ID:
ZDB-GENE-030131-4120
Description:
Myeloid/lymphoid or mixed-lineage leukemia 5 (Trithorax homolog, Drosophila)Novel protein (Zgc:64223
Human Orthologue:
MLL5
Human Description:
myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Mll5
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 5 Gene [Source:MGI Symbol;Acc:MGI:1924825]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20276 Nonsense Mutation detected in F1 DNA During 2014
sa13142 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066903 Nonsense 89 334 4 9
ENSDART00000123369 Nonsense 89 1265 4 21
ENSDART00000126732 Nonsense 89 1375 3 23
ENSDART00000130072 Nonsense 89 381 4 9
Genomic Location:
Chromosome 4 (position 21381169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGCCGGCGTCCCCACCTCCCTCGGTGCTGATCCGGCCGGGCGAGAGCT[T/A]GTTTGTGTCCGGAAGCCGGCCTGGTGAGAACTTGTTTGTGCCGGGCGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066903 None None 334 None 9
ENSDART00000123369 Nonsense 487 1265 11 21
ENSDART00000126732 Nonsense 487 1375 10 23
ENSDART00000130072 None None 381 None 9
Genomic Location:
Chromosome 4 (position 21374414)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTCAAGCAYAACCTGGAGCCCACAGAGAATCTWGGCTCTAGCACA[C/T]GACGGCGAGGCCGTAAGGACAAAGAACCATCGCGGGACGAGAGCGGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ningqrh9