rpe65a

Ensembl ID:
ENSDARG00000007480
ZFIN ID:
ZDB-GENE-040426-1717
Description:
retinal pigment epithelium abundant protein RPE65 [Source:RefSeq peptide;Acc:NP_957045]
Human Orthologue:
RPE65
Human Description:
retinal pigment epithelium-specific protein 65kDa [Source:HGNC Symbol;Acc:10294]
Mouse Orthologue:
Rpe65
Mouse Description:
retinal pigment epithelium 65 Gene [Source:MGI Symbol;Acc:MGI:98001]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16919 Nonsense Available for shipment Available now
sa44520 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30810 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Nonsense 169 531 6 14
Genomic Location (Zv9):
Chromosome 2 (position 2459727)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2327379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWTCAATCTTTAATAACCTCCGCTTGATGACCCCTGCAGGTTGACATGTG[T/A]AATTATGTGAACATYAATGGAGTCACGGCGCATCCTCACATCGAGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Essential Splice Site 286 531 8 14
Genomic Location (Zv9):
Chromosome 2 (position 2455117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGGATCCAACTATATGGACTGCTTCGAGTCGGATGAAGAGAAAGGC[G/A]TAGGTTCCTCTTTATCTCACACTCGTTTTATCCGCACTATGGTGCTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Nonsense 461 531 13 14
Genomic Location (Zv9):
Chromosome 2 (position 2450156)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2317808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTATAGATTTGCAAGCTGAATGTGAGGACTAAGGAGACCTGGGTATGG[C/T]AGGAGCCCGACTCGTACCCTTCGGAGCCGCTGTTTGTACAGACTCCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link