rpe65a

Ensembl ID:
ENSDARG00000007480
ZFIN ID:
ZDB-GENE-040426-1717
Description:
retinal pigment epithelium abundant protein RPE65 [Source:RefSeq peptide;Acc:NP_957045]
Human Orthologue:
RPE65
Human Description:
retinal pigment epithelium-specific protein 65kDa [Source:HGNC Symbol;Acc:10294]
Mouse Orthologue:
Rpe65
Mouse Description:
retinal pigment epithelium 65 Gene [Source:MGI Symbol;Acc:MGI:98001]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16919 Nonsense Available for shipment Available now
sa30810 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa16919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Nonsense 169 531 6 14
Genomic Location:
Chromosome 2 (position 2459727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWTCAATCTTTAATAACCTCCGCTTGATGACCCCTGCAGGTTGACATGTG[T/A]AATTATGTGAACATYAATGGAGTCACGGCGCATCCTCACATCGAGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Nonsense 461 531 13 14
Genomic Location:
Chromosome 2 (position 2450156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTATAGATTTGCAAGCTGAATGTGAGGACTAAGGAGACCTGGGTATGG[C/T]AGGAGCCCGACTCGTACCCTTCGGAGCCGCTGTTTGTACAGACTCCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vzv9gpmm