fbxo8

Ensembl ID:
ENSDARG00000007477
ZFIN IDs:
ZDB-GENE-060421-7091, ZDB-GENE-060421-7091
Description:
F-box only protein 8 [Source:RefSeq peptide;Acc:NP_001035397]
Human Orthologue:
FBXO8
Human Description:
F-box protein 8 [Source:HGNC Symbol;Acc:13587]
Mouse Orthologue:
Fbxo8
Mouse Description:
F-box protein 8 Gene [Source:MGI Symbol;Acc:MGI:1354696]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13814 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015323 Nonsense 109 323 2 6
ENSDART00000129583 Nonsense 109 323 1 5
Genomic Location:
Chromosome 1 (position 38765426)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTGACCTCTGCCTGGCCTCCTGCGTGTGGCAAGACCTGGGCAGTGAT[G/T]AGTACCTGTGGCAGGGGTCAGTCAAGTGTTCAATTTTTATACCAAATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5mgrh71r