tdrd1

Ensembl ID:
ENSDARG00000007465
ZFIN ID:
ZDB-GENE-070803-1
Description:
Tudor domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q58EK5]
Human Orthologue:
TDRD1
Human Description:
tudor domain containing 1 [Source:HGNC Symbol;Acc:11712]
Mouse Orthologue:
Tdrd1
Mouse Description:
tudor domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1933218]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16285 Essential Splice Site Available for shipment Available now
sa4472 Nonsense Mutation detected in F1 DNA During 2014
sa7364 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066249 Essential Splice Site 128 1176 4 25
Genomic Location:
Chromosome 12 (position 31932350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCGCACATCGACATGTTTGCAAACCCAGCATTCCAGAAGTCACAAGG[T/A]AATATTATTTATATTCTGTTTATAACTCATTTTGAATGTTAGTTTTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066249 Nonsense 515 1176 13 25
Genomic Location:
Chromosome 12 (position 31929200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTAAATCGCTTAAGGCCGATCAGCAAGGAGCTGTTGGCTTTGGCAACA[C/T]AAGCAATCCCCTGTTCTCTAGCAGGTATACTGCAACCCTAGAACATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066249 Missense 795 1176 18 25
Genomic Location:
Chromosome 12 (position 31927361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRAGAAGGGTTATGGGATGGAGCTRGAAAGKGCTGGACAAACTGTTGCTT[C/T]TGTGCTCATCTCTGAGCACCTGGMTAAACCTTACGGACAGGTCAGACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lu5bwalk