si:ch211-238a12.4

Ensembl ID:
ENSDARG00000007461
ZFIN ID:
ZDB-GENE-050420-284
Description:
Novel protein similar to H.sapiens SRGAP1, SLIT-ROBO Rho GTPase activating protein 1 (SRGAP1) [Sourc
Human Orthologue:
SRGAP1
Human Description:
SLIT-ROBO Rho GTPase activating protein 1 [Source:HGNC Symbol;Acc:17382]
Mouse Orthologue:
Srgap1
Mouse Description:
SLIT-ROBO Rho GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:2152936]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43065 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25055 Nonsense Mutation detected in F1 DNA During 2017
sa23247 Nonsense Available for shipment Available now
sa16150 Nonsense Available for shipment Available now
sa36592 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32190 Essential Splice Site Available for shipment Available now
sa43064 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Essential Splice Site 167 1073 4 22
ENSDART00000140403   None 929 None 18
Genomic Location (Zv9):
Chromosome 18 (position 12411385)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12994014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCAGCTGCAAGAAGATTTGATGAAAGTCCTCAACGAGCTCTACACGG[T/C]AAGTACTGTAACACTTATCACATTTGTCGAATTCTAGAAAGTTCCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Nonsense 175 1073 5 22
ENSDART00000140403 Nonsense 8 929 1 18
Genomic Location (Zv9):
Chromosome 18 (position 12405981)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12988710
KASP Assay ID:
554-7419.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGATCTCTGATCTGTGTCCCGCAGGTGATGAAGACCTATCATATGTA[T/A]CACACAGAGAGCATCAGTGCTGAGGGTAAACTGAAGGAGGCTGAGAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Nonsense 339 1073 7 22
ENSDART00000140403 Nonsense 172 929 3 18
Genomic Location (Zv9):
Chromosome 18 (position 12398361)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12981090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGGAAATGTACCCGACCGCCTTCTGCCCTCCCGTCAAATTTGAGTTT[C/T]AGGCACATATGGGAGACGAGGTCAGTTTTAATTATAATTTTGGATTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Nonsense 400 1073 9 22
ENSDART00000140403 Nonsense 233 929 5 18
Genomic Location (Zv9):
Chromosome 18 (position 12379956)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12962685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAGGCRACACTTACTACCATCCAGGACATGGTGACGGTTGAGGATTA[T/A]GACGTATCTGAAWRTTTCCATCATAGCCGCTCAACTGAATCAGTTAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Essential Splice Site 723 1073 18 22
ENSDART00000140403 Essential Splice Site 579 929 14 18
Genomic Location (Zv9):
Chromosome 18 (position 12351444)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12934173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAGGTTGATCAGGATGGAGGAGCAGAGACCCACACCAGTGAGGATGG[T/A]AAGCTTGTTTTTGTTGTTGTTTTTGTTGTACATCCTGTAGGGATATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Essential Splice Site 783 1073 19 22
ENSDART00000140403 Essential Splice Site 639 929 15 18
Genomic Location (Zv9):
Chromosome 18 (position 12337595)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12920324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGCATAGATGGACTCGTGCCTCACCAGTACATTGTTGTTCAGGATAT[G/A]TGAGTATCTGAACTGTTTAGTCAGCAAAATAAAACTTCACTGTAATGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Nonsense 840 1073 21 22
ENSDART00000140403 Nonsense 696 929 17 18
Genomic Location (Zv9):
Chromosome 18 (position 12320244)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12902973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCTCTCCATTTACCAGGCACAGAAAGAGAAGTGACCCTCCAACCCGC[A/T]GACCTCCGGCTCGCCCAACTGACACCCACTGCCTCGTCCACCCATCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link