ift81

Ensembl ID:
ENSDARG00000007444
ZFIN ID:
ZDB-GENE-040714-3
Description:
intraflagellar transport protein 81 homolog [Source:RefSeq peptide;Acc:NP_001002313]
Human Orthologue:
IFT81
Human Description:
intraflagellar transport 81 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:14313]
Mouse Orthologue:
Ift81
Mouse Description:
intraflagellar transport 81 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1098597]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7332 Nonsense Mutation detected in F1 DNA During 2014
hu7911 Nonsense Available for shipment Available now
sa14146 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004288 Nonsense 11 675 1 18
ENSDART00000004288 Nonsense 11 675 1 18

The following transcripts of ENSDARG00000007444 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 12159905)
KASP Assay ID:
554-2408.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTAACGNNNNNNTAATTCTTCAARATGAGCGAACAGCTYAAATTTATCGTTGAA[C/T]AGCTGAACAAGGAGCCTTTCAAGAAAAACTTCAATCTCATTACATTCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004288 Nonsense 11 675 1 18
ENSDART00000004288 Nonsense 11 675 1 18

The following transcripts of ENSDARG00000007444 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 12159905)
KASP Assay ID:
554-2408.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTAACGNNNNNNTAAYKYTTYAAGRWGAGCGAACAGCTYAAATTTATCGTTGAA[C/T]AGCTGAACAAGGAGCCTTTCAAGAAAAACTTCAATCTCATTASATTCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004288 Nonsense 306 675 8 18

The following transcripts of ENSDARG00000007444 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 12166327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGGTGRTGCAGTACCTACARAAGGTGGCGTCTGAGCCTGCTATGGGC[C/T]AGGCAGAACTGAGGGAGCTKGAGGACAAGGTGAGCTTTTAAAGGGATAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/umxw4upq