fbxl18

Ensembl ID:
ENSDARG00000007443
ZFIN ID:
ZDB-GENE-050913-65
Description:
F-box/LRR-repeat protein 18 [Source:RefSeq peptide;Acc:NP_001025416]
Human Orthologue:
FBXL18
Human Description:
F-box and leucine-rich repeat protein 18 [Source:HGNC Symbol;Acc:21874]
Mouse Orthologue:
Fbxl18
Mouse Description:
F-box and leucine-rich repeat protein 18 Gene [Source:MGI Symbol;Acc:MGI:2444450]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa767 Nonsense F2 line generated During 2014
sa9554 Nonsense Available for shipment Available now
sa19420 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa767
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103644 Nonsense 307 720 3 5
Genomic Location:
Chromosome 1 (position 7719635)
KASP Assay ID:
554-0673.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAGCTTCCACGTACATGGTTGGACGGTGCTATACTTGGGCGGGTRT[T/A]AGCGCATGGATGTCCTGCATACCTGAATGTCTCCCGGTGTTCATCTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103644 Nonsense 598 720 3 5
Genomic Location:
Chromosome 1 (position 7718762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGCAGGCCCTGCTGGAGGCTCTTTCCTACTGCACACAASTCAGGGAST[T/A]AAGGTGAGCGTGCAYGCCAATACTCAAAAKGTAATCAATAAGGTTGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103644 Nonsense 625 720 4 5
Genomic Location:
Chromosome 1 (position 7716045)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCGTTTTTCGAAGCGCTCAGTCAGTGTGGTCAGCTGCGGCGTCTGTG[T/A]TTAGTTTCTCGACACGGCACTTTCCAACCCGCCGCTGTGACGGCCTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p6275op5