arid2

Ensembl ID:
ENSDARG00000007413
ZFIN ID:
ZDB-GENE-030131-6311
Description:
AT-rich interactive domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001071231]
Human Orthologue:
ARID2
Human Description:
AT rich interactive domain 2 (ARID, RFX-like) [Source:HGNC Symbol;Acc:18037]
Mouse Orthologue:
Arid2
Mouse Description:
AT rich interactive domain 2 (ARID, RFX-like) Gene [Source:MGI Symbol;Acc:MGI:1924294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20174 Nonsense Available for shipment Available now
sa6926 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019144 Nonsense 424 1565 10 21
ENSDART00000113360 Nonsense 424 1573 10 21
Genomic Location:
Chromosome 4 (position 1520812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACGCTGCCGGACGTCATGCTGGTCATCTCTGCGCTGGAGGTCCTGTA[T/A]CAGCTGGCTGAGCTCGGAGAGATAACCTGCTCCAAAATCTCCTCCGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019144 Nonsense 1381 1565 16 21
ENSDART00000113360 Nonsense 1382 1573 16 21
Genomic Location:
Chromosome 4 (position 1515418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGCCCTCTCTCCAGAGCAAACRCGGAAACCTGGACAGAACTTTAAGTG[T/A]CTGTGGCAAGCATGCAAACGGTAAGAAAGCAYGCTTTACRGATGTWCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hippocampal atrophy: Hippocampal atrophy as a quantitative trait in a genome-wide association study identifying novel susceptibility genes for Alzheimer's disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kt41cz8n