barx1

Ensembl ID:
ENSDARG00000007407
ZFIN ID:
ZDB-GENE-050522-28
Description:
Homeobox protein BarH-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q503F2]
Human Orthologue:
BARX1
Human Description:
BARX homeobox 1 [Source:HGNC Symbol;Acc:955]
Mouse Orthologue:
Barx1
Mouse Description:
BarH-like homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:103124]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10360 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023889 Essential Splice Site 165 248 2 4
Genomic Location:
Chromosome 11 (position 28421730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTGGAAAAACGATTTGAAAAACAGAAKTATCTTTCAACCCCTGACAG[G/A]TAAATACGCGTTTTAWTTGATGCATTTATTTAGGTGTCGATGTTTGANNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vacsvjeu