LOC100332050

Ensembl ID:
ENSDARG00000007398
Human Orthologue:
LRRK1
Human Description:
leucine-rich repeat kinase 1 [Source:HGNC Symbol;Acc:18608]
Mouse Orthologue:
Lrrk1
Mouse Description:
leucine-rich repeat kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2142227]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13125 Essential Splice Site Available for shipment Available now
sa13011 Nonsense Available for shipment Available now
sa12644 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029668 Essential Splice Site 226 1389 4 25
Genomic Location:
Chromosome 7 (position 10474921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTGCCATCATCACCGGTTTGCCTCTGTATGCTGCGGCTCAGGGAGG[T/C]ACTGAACATKAWGAACGGAAATTTGAAATTTGTGTTGCCTGTTCATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029668 Nonsense 293 1389 6 25
Genomic Location:
Chromosome 7 (position 10465178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCATGTTGACTGGTCTGGACTGAAGCTGTCCTGGTTGGATCTGGACT[G/A]GTTTATGGACGWRTCGTCTCGCATCACCGTTCTGGATCTCTCTCGTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029668 Nonsense 740 1389 15 25
Genomic Location:
Chromosome 7 (position 10436167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGCATGTCGACGGTCAACCAGTGTTTCTTCACTGATAAAGCTCTGTA[T/A]ATGGTGATCTGGAATCTGGCTTTAGGAGAAGAAGCCGTGGCAAACCTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ghw176m2