irf2a

Ensembl ID:
ENSDARG00000007387
ZFIN ID:
ZDB-GENE-030131-4135
Description:
interferon regulatory factor 2 [Source:RefSeq peptide;Acc:NP_996937]
Human Orthologue:
IRF2
Human Description:
interferon regulatory factor 2 [Source:HGNC Symbol;Acc:6117]
Mouse Orthologue:
Irf2
Mouse Description:
interferon regulatory factor 2 Gene [Source:MGI Symbol;Acc:MGI:96591]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38281 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024945 Splice Site, Nonsense 217 341 6 8
ENSDART00000130270   None 140 None 5
ENSDART00000131954 Splice Site, Nonsense 217 303 7 9
Genomic Location (Zv9):
Chromosome 1 (position 40239200)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39158599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAACAGGCCACTCGGCCTCTCCAGGATTCTCATGTTTCGTCGTACAGT[G/T]GTAGGGTTCATTTTTGCATTCATCTCTAATGTCCTCAAATGCAACTGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link