cct7

Ensembl ID:
ENSDARG00000007385
ZFIN ID:
ZDB-GENE-020419-7
Description:
T-complex protein 1 subunit eta [Source:RefSeq peptide;Acc:NP_775355]
Human Orthologue:
CCT7
Human Description:
chaperonin containing TCP1, subunit 7 (eta) [Source:HGNC Symbol;Acc:1622]
Mouse Orthologue:
Cct7
Mouse Description:
chaperonin containing Tcp1, subunit 7 (eta) Gene [Source:MGI Symbol;Acc:MGI:107184]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21108 Nonsense Mutation detected in F1 DNA During 2014
sa21107 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2381 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa21108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006802 Nonsense 86 547 3 11
ENSDART00000014899 Nonsense 91 422 3 9

The following transcripts of ENSDARG00000007385 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 60630929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGTTGTGCATCCTGCAGCCAAGACTCTGGTGGACATTGCTAGATCT[C/T]AAGATGCTGAGGTAAGATGACCTCTTCATTTTTATGGATTTAGTCCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006802 Essential Splice Site 89 547 None 11
ENSDART00000014899 Essential Splice Site 94 422 None 9

The following transcripts of ENSDARG00000007385 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 60630916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAGCCAAGACTCTGGTGGACATTGCTAGATCTCAAGATGCTGAGG[T/G]AAGATGACCTCTTCATTTTTATGGATTTAGTCCAATAGTTTTCTAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2381
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006802 Essential Splice Site 262 547 7 11
ENSDART00000014899 None None 422 None 9

The following transcripts of ENSDARG00000007385 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 60626107)
KASP Assay ID:
554-3299.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATATAAATGAANTTAGTTGTTTACCCTTGTTTTAATGTGGCTGTTTGC[A/T]GGACTATCAGGCCATTGTTGATGCTGAATGGAACATCCTGTATGATAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0o15bd5w