odc1

Ensembl ID:
ENSDARG00000007377
ZFIN ID:
ZDB-GENE-010816-1
Description:
ornithine decarboxylase [Source:RefSeq peptide;Acc:NP_571876]
Human Orthologue:
ODC1
Human Description:
ornithine decarboxylase 1 [Source:HGNC Symbol;Acc:8109]
Mouse Orthologue:
Odc1
Mouse Description:
ornithine decarboxylase, structural 1 Gene [Source:MGI Symbol;Acc:MGI:97402]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19190 Nonsense Mutation detected in F1 DNA During 2014
sa4012 Nonsense Confirmed mutation in F2 line During 2014
sa9608 Essential Splice Site Available for shipment Available now
sa11170 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017510 Nonsense 41 461 3 10
ENSDART00000017510 Nonsense 41 461 3 10
Genomic Location:
Chromosome 17 (position 52275346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCGTTCTCACCCCGTCTCCTCTTTCAGGATGATAAAGATGCCTTCTA[T/A]GTGGCGGATCTGGGGGATGTCCTGAAGAAGCACCTCCGCTGGCTGCGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4012
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017510 Nonsense 41 461 3 10
ENSDART00000017510 Nonsense 41 461 3 10
Genomic Location:
Chromosome 17 (position 52275346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCGTTCTCACCCCGTSTCCTCTTTCAGGATGATAAAGATGCCTTCTA[T/A]GTGGCGGATCTGGGGGATGTCCTGAAGAAGCACCTCCGCTGGCTGCGTGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
whole organism
ZFA:0001094
degenerate
PATO:0000639
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
yolk
ZFA:0000084
quality
PATO:0000001
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa9608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017510 Essential Splice Site 150 461 4 10
Genomic Location:
Chromosome 17 (position 52275933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RACAGCGAGGTGGAGCTCATGAAGGTGGCCCGTAGCCACGAAAATGCCAA[G/A]TAAGAAAATTACTTYATTACAGGACAASAGCGCTCCAATCATTGAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017510 Nonsense 390 461 9 10
Genomic Location:
Chromosome 17 (position 52281434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGACATGCAGGTGGGCGACTGGCTGSTGTTCGAGAACATGGGCGCCTA[C/A]ACCGTCGCCGCATCCTCCACCTTCAATGGCTTCCAGAAACCCGATATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z35dko3u