odc1

Ensembl ID:
ENSDARG00000007377
ZFIN ID:
ZDB-GENE-010816-1
Description:
ornithine decarboxylase [Source:RefSeq peptide;Acc:NP_571876]
Human Orthologue:
ODC1
Human Description:
ornithine decarboxylase 1 [Source:HGNC Symbol;Acc:8109]
Mouse Orthologue:
Odc1
Mouse Description:
ornithine decarboxylase, structural 1 Gene [Source:MGI Symbol;Acc:MGI:97402]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9608 Essential Splice Site Available for shipment Available now
sa11170 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017510 Essential Splice Site 150 461 4 10
Genomic Location (Zv9):
Chromosome 17 (position 52275933)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51660588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RACAGCGAGGTGGAGCTCATGAAGGTGGCCCGTAGCCACGAAAATGCCAA[G/A]TAAGAAAATTACTTYATTACAGGACAASAGCGCTCCAATCATTGAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017510 Nonsense 390 461 9 10
Genomic Location (Zv9):
Chromosome 17 (position 52281434)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51666089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGACATGCAGGTGGGCGACTGGCTGSTGTTCGAGAACATGGGCGCCTA[C/A]ACCGTCGCCGCATCCTCCACCTTCAATGGCTTCCAGAAACCCGATATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link