dysf

Ensembl ID:
ENSDARG00000007370
ZFIN ID:
ZDB-GENE-070501-1
Human Orthologue:
DYSF
Human Description:
dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive) [Source:HGNC Symbol;Acc:3097]
Mouse Orthologue:
Dysf
Mouse Description:
dysferlin Gene [Source:MGI Symbol;Acc:MGI:1349385]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30886 Nonsense Mutation detected in F1 DNA During 2017
sa40888 Nonsense Mutation detected in F1 DNA During 2017
sa40887 Nonsense Mutation detected in F1 DNA During 2017
sa20934 Essential Splice Site Available for shipment Available now
sa11331 Nonsense Available for shipment Available now
sa17832 Nonsense Available for shipment Available now
sa26952 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082620 Nonsense 82 1193 4 31
ENSDART00000131987   None 1847 None 48
ENSDART00000135018 Nonsense 158 319 6 10
ENSDART00000135415   None 1847 None 48
ENSDART00000142754 Nonsense 156 317 6 10
ENSDART00000082620 Nonsense 82 1193 4 31
ENSDART00000131987   None 1847 None 48
ENSDART00000135018 Nonsense 158 319 6 10
ENSDART00000135415   None 1847 None 48
ENSDART00000142754 Nonsense 156 317 6 10
Genomic Location (Zv9):
Chromosome 7 (position 26841844)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25403590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTGCAATGTGATTTATCTTACTTGTGTATATGTGCAGTTTTCTCAT[T/A]GGACACTATGGGCGAGGATGACACTGAGAGCATGCTGATGATGGAGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082620 Nonsense 82 1193 4 31
ENSDART00000131987   None 1847 None 48
ENSDART00000135018 Nonsense 158 319 6 10
ENSDART00000135415   None 1847 None 48
ENSDART00000142754 Nonsense 156 317 6 10
ENSDART00000082620 Nonsense 82 1193 4 31
ENSDART00000131987   None 1847 None 48
ENSDART00000135018 Nonsense 158 319 6 10
ENSDART00000135415   None 1847 None 48
ENSDART00000142754 Nonsense 156 317 6 10
Genomic Location (Zv9):
Chromosome 7 (position 26841844)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25403590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTGCAATGTGATTTATCTTACTTGTGTATATGTGCAGTTTTCTCAT[T/A]GGACACTATGGGCGAGGATGACACTGAGAGCATGCTGATGATGGAGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082620 Nonsense 111 1193 4 31
ENSDART00000131987   None 1847 None 48
ENSDART00000135018 Nonsense 187 319 6 10
ENSDART00000135415   None 1847 None 48
ENSDART00000142754 Nonsense 185 317 6 10
Genomic Location (Zv9):
Chromosome 7 (position 26841758)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25403504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGATGGAGGTGGCGGAGGAGCCTGAACCTGTTCCAGGACCCCAGGGG[C/T]AGGACATCGGCGCCCCTACAGCACCACCCAAAAAGGCTCCACCCAACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082620 Essential Splice Site 851 1193 23 31
ENSDART00000131987 Essential Splice Site 700 1847 19 48
ENSDART00000135018   None 319 None 10
ENSDART00000135415 Essential Splice Site 700 1847 19 48
ENSDART00000142754   None 317 None 10
Genomic Location (Zv9):
Chromosome 7 (position 26823450)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25385196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCAGGCTGGAGCTGGGCAGGAGAATGGTTCATCAGCCCAGAGAAAAC[G/T]TGAGTACCATCTTATCTTTAGAAGGGACATATGCATCATTAAACACCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082620 Nonsense 924 1193 25 31
ENSDART00000131987 Nonsense 773 1847 21 48
ENSDART00000135018   None 319 None 10
ENSDART00000135415 Nonsense 773 1847 21 48
ENSDART00000142754   None 317 None 10
Genomic Location (Zv9):
Chromosome 7 (position 26822988)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25384734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGGAGGATATTGAGTGGAGYGAGGATCTGAAGCGTGCAGTGGATGAT[C/T]AAGGTATGGAAAYTKTATCCCATACASGTGAACAACTGACGTTTTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082620 Nonsense 1011 1193 27 31
ENSDART00000131987 Nonsense 860 1847 23 48
ENSDART00000135018   None 319 None 10
ENSDART00000135415 Nonsense 860 1847 23 48
ENSDART00000142754   None 317 None 10
Genomic Location (Zv9):
Chromosome 7 (position 26816334)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25378080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCAAGCAGAAGAAAACCGACTTGTTCCGTCGCCGGCGCTGGAGACGT[C/T]GAATGGAGCCATTAGAAAAGACRGGGCCGGCGGCCATCYTTGCCTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082620   None 1193 None 31
ENSDART00000131987 Nonsense 1153 1847 32 48
ENSDART00000135018   None 319 None 10
ENSDART00000135415 Nonsense 1153 1847 32 48
ENSDART00000142754   None 317 None 10
Genomic Location (Zv9):
Chromosome 7 (position 26785252)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25346998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTTGCGTCACTCTTTTTTTATTGTTCACATTTCTGCACTCTCTTCAG[C/T]GATTGCCTAAGGAAGAGCTCTACATGCCCCCATTGGTGATCAAGGTTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link