fgf20a

Ensembl ID:
ENSDARG00000007356
ZFIN ID:
ZDB-GENE-060110-1
Description:
fibroblast growth factor 20a [Source:RefSeq peptide;Acc:NP_001032180]
Human Orthologues:
FGF20, FGF9
Human Descriptions:
fibroblast growth factor 20 [Source:HGNC Symbol;Acc:3677]
fibroblast growth factor 9 (glia-activating factor) [Source:HGNC Symbol;Acc:3687]
Mouse Orthologues:
Fgf20, Fgf9
Mouse Descriptions:
fibroblast growth factor 20 Gene [Source:MGI Symbol;Acc:MGI:1891346]
fibroblast growth factor 9 Gene [Source:MGI Symbol;Acc:MGI:104723]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19457 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013024 Essential Splice Site 93 208 1 3
Genomic Location:
Chromosome 1 (position 15135997)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCGGACGGTTCGGTCCAAGGCACGAGGAAGGACCACAGCAGATTTGG[T/G]AAGTATTATCTGGCGTTGTTTTATAATTGCAATTAATCAGTGCATGCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6w9ms8yv