pdia3

Ensembl ID:
ENSDARG00000007354
ZFIN ID:
ZDB-GENE-031002-9
Description:
Sb:cb825 protein [Source:UniProtKB/TrEMBL;Acc:Q803D7]
Human Orthologue:
PDIA3
Human Description:
protein disulfide isomerase family A, member 3 [Source:HGNC Symbol;Acc:4606]
Mouse Orthologue:
Pdia3
Mouse Description:
protein disulfide isomerase associated 3 Gene [Source:MGI Symbol;Acc:MGI:95834]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16170 Essential Splice Site Available for shipment Available now
sa16372 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011389 Essential Splice Site 191 492 5 13
ENSDART00000011389 Essential Splice Site 191 492 5 13
Genomic Location (Zv9):
Chromosome 25 (position 31340619)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29907980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCACACTAACAATGAGGATCTGTTAAAGAAACATGGCATTGATGGAGA[G/A]TATGTAGCTTTTATTTGTGTTAAAGTGATATTMGTTGTAGTTTTGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011389 Essential Splice Site 191 492 5 13
ENSDART00000011389 Essential Splice Site 191 492 5 13
Genomic Location (Zv9):
Chromosome 25 (position 31340619)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29907980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCACACTAACAATGAGGATCTGTTAAAGAAACATGGCATTGATGGAGA[G/A]TATGTAGCTTTTATTTGTGTTAAAGTGATATTMGTTGTAGTTTTGAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link