dmrt1

Ensembl ID:
ENSDARG00000007349
ZFIN ID:
ZDB-GENE-050511-1
Description:
doublesex- and mab-3-related transcription factor 1 isoform 1 [Source:RefSeq peptide;Acc:NP_991191]
Human Orthologue:
DMRT1
Human Description:
doublesex and mab-3 related transcription factor 1 [Source:HGNC Symbol;Acc:2934]
Mouse Orthologue:
Dmrt1
Mouse Description:
doublesex and mab-3 related transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1354733]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31472 Nonsense Available for shipment Available now
sa26559 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044361 Nonsense 48 267 1 5
ENSDART00000124637 Nonsense 48 268 1 5
ENSDART00000126066 Nonsense 48 256 1 5
ENSDART00000128825 Nonsense 48 191 1 4
ENSDART00000130428 Nonsense 48 190 1 4

The following transcripts of ENSDARG00000007349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46563669)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44344934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCGCTGAAGGGCCACAAACGCTTCTGTAATTGGAGAGACTGCCAGTG[T/A]CAGAAATGCAGACTCATCGCCGAGAGACAGCGGGTCATGGCTGCCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044361 Splice Site None 267 None 5
ENSDART00000124637 Essential Splice Site 224 268 None 5
ENSDART00000126066   None 256 None 5
ENSDART00000128825 Essential Splice Site 177 191 None 4
ENSDART00000130428 Splice Site None 190 None 4

The following transcripts of ENSDARG00000007349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46608090)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44389355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGCCAATAATAAACACCAAATAGTTCATGTTTCATGATCCATCCCAT[T/A]TCAGCTTTCTCCGATGGAGCTCAAGACTCTGTGTCCATCAGCTCGATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link