degs1

Ensembl ID:
ENSDARG00000007347
ZFIN ID:
ZDB-GENE-030131-5283
Description:
sphingolipid delta(4)-desaturase DES1 [Source:RefSeq peptide;Acc:NP_997865]
Human Orthologue:
DEGS1
Human Description:
degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) [Source:HGNC Symbol;Acc:13709]
Mouse Orthologues:
9130409I23Rik, Degs1
Mouse Descriptions:
degenerative spermatocyte homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1097711]
RIKEN cDNA 9130409I23 gene Gene [Source:MGI Symbol;Acc:MGI:3588271]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22188 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013007 Nonsense 246 323 2 3
ENSDART00000127095 Nonsense 246 350 2 4
ENSDART00000137494   None 40 None 3
Genomic Location (Zv9):
Chromosome 13 (position 383366)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 381349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCTGAACATTACATGTTCCTCAAAGGCCACGAGACCTACTCTTACTA[C/A]GGCTCTCTGAACCTGCTGACGTTCAACGTCGGCTACCATAACGAGCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link