tmpo

Ensembl ID:
ENSDARG00000007315
ZFIN ID:
ZDB-GENE-030131-6003
Description:
thymopoietin [Source:RefSeq peptide;Acc:NP_851299]
Human Orthologue:
TMPO
Human Description:
thymopoietin [Source:HGNC Symbol;Acc:11875]
Mouse Orthologue:
Tmpo
Mouse Description:
thymopoietin Gene [Source:MGI Symbol;Acc:MGI:106920]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6936 Nonsense Mutation detected in F1 DNA During 2014
sa11203 Nonsense Available for shipment Available now
sa17619 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016690 Nonsense 410 685 11 15
ENSDART00000042874 Nonsense 310 515 8 11
ENSDART00000044005 None None 369 None 6
ENSDART00000125762 Nonsense 410 657 11 15
Genomic Location:
Chromosome 4 (position 15930223)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTAATAAATCAGGTGGATGACCAGGGTATGCAGGACGTCCTGAGCTG[T/A]AGATCTGCAAATGGTGGTCTTCTGGTAWGTTTCGCAGTTATGCACTGYTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016690 Nonsense 473 685 12 15
ENSDART00000042874 None None 515 None 11
ENSDART00000044005 None None 369 None 6
ENSDART00000125762 None None 657 None 15
Genomic Location:
Chromosome 4 (position 15929951)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAAAAAGAGGTTTTCCCATCACATTCACTTCCTTACAAGAACTTCTG[T/A]TTGGTTTCTGAGGACTCTCTTACTGTGTCATGTGAACTTTCTCAGGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016690 Essential Splice Site 530 685 13 15
ENSDART00000042874 None None 515 None 11
ENSDART00000044005 None None 369 None 6
ENSDART00000125762 Essential Splice Site 502 657 13 15
Genomic Location:
Chromosome 4 (position 15928702)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCGAGGACTCGATAACAAGCTGATGGRTATGAAGGAGACAATGATGG[T/A]AACTTTGAGCTACATGGTGTTTGGCTCCACCGGTGGTTAATTGGGATGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/272mggsx