aco2

Ensembl ID:
ENSDARG00000007294
ZFIN ID:
ZDB-GENE-030131-1390
Description:
aconitate hydratase, mitochondrial [Source:RefSeq peptide;Acc:NP_944590]
Human Orthologue:
ACO2
Human Description:
aconitase 2, mitochondrial [Source:HGNC Symbol;Acc:118]
Mouse Orthologue:
Aco2
Mouse Description:
aconitase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:87880]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22076 Nonsense Mutation detected in F1 DNA During 2014
sa24909 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009321 Nonsense 257 782 6 17
Genomic Location:
Chromosome 12 (position 20211473)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGTTGGAGCTCACCAAAGGATGTCATCCTGAAAGTTGCTGGTATTT[T/A]GACTGTGAAGGGTGGCACTGGTGCCATTGTGGAGTATCATGGCCCTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009321 Essential Splice Site 346 782 8 17
Genomic Location:
Chromosome 12 (position 20209754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCGGGTTGTCATTATGACCAGCTGATTGAGATTAATCTAGATGAGG[T/G]AAGTGTAGGTCAATTGAGGTAATCCACTTAAATGTGCGTTACAGATACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mn7n3i62