mrp63

Ensembl ID:
ENSDARG00000007285
ZFIN ID:
ZDB-GENE-040426-1745
Description:
Ribosomal protein 63, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6PBR7]
Human Orthologue:
MRP63
Human Description:
mitochondrial ribosomal protein 63 [Source:HGNC Symbol;Acc:14514]
Mouse Orthologue:
Mrp63
Mouse Description:
mitochondrial ribosomal protein 63 Gene [Source:MGI Symbol;Acc:MGI:1915090]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36426 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016608 Nonsense 41 103 2 2
ENSDART00000133402 Nonsense 46 108 2 2

The following transcripts of ENSDARG00000007285 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 26450516)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26590435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGACCTGTTACCTGGCAGATAAAGCGGAATGTGATCAAACGGCTAGAA[C/T]AAGAAGCAGAGAATGAATACTGGATCAGCCGGCCATTCATGACGCTGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link