ect2

Ensembl ID:
ENSDARG00000007278
ZFIN ID:
ZDB-GENE-040831-2
Description:
protein ECT2 [Source:RefSeq peptide;Acc:NP_001003883]
Human Orthologue:
ECT2
Human Description:
epithelial cell transforming sequence 2 oncogene [Source:HGNC Symbol;Acc:3155]
Mouse Orthologue:
Ect2
Mouse Description:
ect2 oncogene Gene [Source:MGI Symbol;Acc:MGI:95281]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35030 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41785 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011087 Essential Splice Site 506 878 15 24
ENSDART00000081827 Essential Splice Site 538 976 16 26
Genomic Location (Zv9):
Chromosome 11 (position 10485368)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10437682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAATGGCAGCTTTTGTGATCTCTCTTTATTTTTTCAAATTCCCTCTCA[G/A]TCTGGAGAGCTGGTGAAGGCCTACCCACCATTTGTCAACTTCTTTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011087 Nonsense 595 878 17 24
ENSDART00000081827 Nonsense 627 976 18 26
Genomic Location (Zv9):
Chromosome 11 (position 10482768)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10435082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACACATCAGATGACAACCCAGATAAATTGACACTTGAAAAGGCCATC[G/T]AGTCTCTCAAGGAAGTGATGACGTGAGTCCTTATTGTCCTTATATAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link