myf5

Ensembl ID:
ENSDARG00000007277
ZFIN ID:
ZDB-GENE-000616-6
Description:
myogenic factor 5 [Source:RefSeq peptide;Acc:NP_571651]
Human Orthologue:
MYF5
Human Description:
myogenic factor 5 [Source:HGNC Symbol;Acc:7565]
Mouse Orthologue:
Myf5
Mouse Description:
myogenic factor 5 Gene [Source:MGI Symbol;Acc:MGI:97252]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu2022 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu2022
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014818 Nonsense 32 254 1 3
ENSDART00000112035 Nonsense 15 237 1 4
ENSDART00000127664 Nonsense 15 237 1 3
Genomic Location:
Chromosome 4 (position 20676996)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATCATGGACGTATTCTCCACATCCCAGATCTTCTACGACAGCACTTG[C/A]GCTTCGTCTCCTGAAGATTTAGAGTTTGGAGCCAGTGGGGAACTGACCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ktduj4b4