ela3l

Ensembl ID:
ENSDARG00000007276
ZFIN ID:
ZDB-GENE-060710-2
Description:
elastase 3 like [Source:RefSeq peptide;Acc:NP_001019579]
Human Orthologues:
CELA2A, CELA2B, CTRC
Human Descriptions:
chymotrypsin C (caldecrin) [Source:HGNC Symbol;Acc:2523]
chymotrypsin-like elastase family, member 2A [Source:HGNC Symbol;Acc:24609]
chymotrypsin-like elastase family, member 2B [Source:HGNC Symbol;Acc:29995]
Mouse Orthologues:
Cela2a, Cela3b, Ctrc, Gm13011
Mouse Descriptions:
chymotrypsin C (caldecrin) Gene [Source:MGI Symbol;Acc:MGI:1923951]
chymotrypsin-like elastase family, member 2A Gene [Source:MGI Symbol;Acc:MGI:95316]
chymotrypsin-like elastase family, member 3B Gene [Source:MGI Symbol;Acc:MGI:1915118]
predicted gene 13011 Gene [Source:MGI Symbol;Acc:MGI:3651647]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18102 Nonsense Available for shipment Available now
sa20417 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009028 Nonsense 111 269 4 8
ENSDART00000078932 Nonsense 111 267 4 10
Genomic Location:
Chromosome 5 (position 27760999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGRATCCCAGACCATCAGCGCACAGAAGATCATTGTACACGAGAAATG[G/A]AACTCAATGTTTGTTGCTCTTGGGTAAGTTTKWGATATTCTCATTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009028 Nonsense 156 269 5 8
ENSDART00000078932 Nonsense 156 267 5 10
Genomic Location:
Chromosome 5 (position 27758724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTGTTCCTGCTCCTGGCGATGTCCTCCCAAACAACTACCCTTGCTA[T/G]ATTTCAGGCTGGGGAAGACTCTCCAGTGAGTACTCCTGCACACAAAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pdcli0km