ela3l

Ensembl ID:
ENSDARG00000007276
ZFIN ID:
ZDB-GENE-060710-2
Description:
elastase 3 like [Source:RefSeq peptide;Acc:NP_001019579]
Human Orthologues:
CELA2A, CELA2B, CTRC
Human Descriptions:
chymotrypsin C (caldecrin) [Source:HGNC Symbol;Acc:2523]
chymotrypsin-like elastase family, member 2A [Source:HGNC Symbol;Acc:24609]
chymotrypsin-like elastase family, member 2B [Source:HGNC Symbol;Acc:29995]
Mouse Orthologues:
Cela2a, Cela3b, Ctrc, Gm13011
Mouse Descriptions:
chymotrypsin C (caldecrin) Gene [Source:MGI Symbol;Acc:MGI:1923951]
chymotrypsin-like elastase family, member 2A Gene [Source:MGI Symbol;Acc:MGI:95316]
chymotrypsin-like elastase family, member 3B Gene [Source:MGI Symbol;Acc:MGI:1915118]
predicted gene 13011 Gene [Source:MGI Symbol;Acc:MGI:3651647]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26473 Essential Splice Site Mutation detected in F1 DNA During 2015
sa18102 Nonsense Available for shipment Available now
sa20417 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa26473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009028 Essential Splice Site 14 269 None 8
ENSDART00000078932 Essential Splice Site 14 267 None 10
Genomic Location:
Chromosome 5 (position 27763283)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCAACATGTTCGCCCTCATCCTAGCATCAGTGCTCATCGCCAGCGG[T/C]AAGACTTTTGCACACCAGAACTGCTTAGAGTTATTGTTCTATCATGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009028 Nonsense 111 269 4 8
ENSDART00000078932 Nonsense 111 267 4 10
Genomic Location:
Chromosome 5 (position 27760999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGRATCCCAGACCATCAGCGCACAGAAGATCATTGTACACGAGAAATG[G/A]AACTCAATGTTTGTTGCTCTTGGGTAAGTTTKWGATATTCTCATTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009028 Nonsense 156 269 5 8
ENSDART00000078932 Nonsense 156 267 5 10
Genomic Location:
Chromosome 5 (position 27758724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTGTTCCTGCTCCTGGCGATGTCCTCCCAAACAACTACCCTTGCTA[T/G]ATTTCAGGCTGGGGAAGACTCTCCAGTGAGTACTCCTGCACACAAAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pdcli0km